Bacterial CDS DNA translation

Prompt

Translate this real bacterial coding DNA into its complete protein sequence. This is a complete, spliced CDS on the coding strand, written 5' to 3'. Begin reading triplets at the first base. Use NCBI genetic code 11 and the supplied table. Codon table (DNA letters; one-letter amino-acid codes): TTT F | TTC F | TTA L | TTG L TCT S | TCC S | TCA S | TCG S TAT Y | TAC Y | TAA STOP | TAG STOP TGT C | TGC C | TGA STOP | TGG W CTT L | CTC L | CTA L | CTG L CCT P | CCC P | CCA P | CCG P CAT H | CAC H | CAA Q | CAG Q CGT R | CGC R | CGA R | CGG R ATT I | ATC I | ATA I | ATG M ACT T | ACC T | ACA T | ACG T AAT N | AAC N | AAA K | AAG K AGT S | AGC S | AGA R | AGG R GTT V | GTC V | GTA V | GTG V GCT A | GCC A | GCA A | GCG A GAT D | GAC D | GAA E | GAG E GGT G | GGC G | GGA G | GGG G At the first codon only, a valid start codon (ATA, ATC, ATG, ATT, CTG, GTG, TTG) produces M. At later positions, use the table. Stop translation at the FIRST in-frame STOP codon, even if it occurs before the end of the supplied DNA (a premature stop). Do not include the stop codon or a stop symbol in the protein. Ignore every codon after that stop; do not resume translation or change reading frame. Show codon mappings only through that first stop. The final protein sequence must contain only the amino acids preceding it. Show your translation in consecutive blocks of up to 10 codons, with the corresponding amino acids. Then put the complete translated protein sequence on the final line by itself, using uppercase one-letter amino-acid codes without spaces or a stop symbol. DNA: ATGTCAAACTATGCAATCATCAAAACTGGTGGTAAACAAGTTAAAGTTGAAGAAGGTTCAGTAATCTACGTTGAAAAACTCAATGTTGAAGCTGGTCAAACCGTTACTTTCGACGAAGTTATCTTTGTCGGAGGCGAAACAACTAAAGTTGGTGCACCACTCGTTGAAGGCGCAACTGTTGTTGGTGAAGTCGAAAAACATGGTAAGCAAAAGAAAGTTGTTACTTTCCAATACAAACCTAAAAAACACTCACACCGTAAACAAGGTCACCGTCAACCATACACTAAAGTTGTTATCAAATCAGTTAACGCTTAA /think